MAC-INMV-SSR Database INRA
Home
INMV Typing
MLSSR Typing
Identification of strains Browse Database References
News Webmasters Contact us

MLSSR Typing Method

SSR used on typing method

Marker locus Locus name SSR Genome ORFa No. of allelesb D valuec
1 1793091 GGGGGGGGGGGGGGGGGGGG GI: 13881617 phosphatidylethanolamine-binding protein (Mycobacterium tuberculosis CDC 1551) 5 0.700
2 2719085 GGGGGGGGGG No hitd (210_MAP.128) 30.616
3e 607784 CG CG CG CG CG C IGI: RMMR05031 6-aminohexanoate-cyclic dimer hydrolase (Mycobacterium marinum) 2 0.189
GI: 13883430 hydrolase, alpha/beta-hydrolase fold family (M. tuberculosis CDC1551)
4 3406364 GC GC GC GC GC GI: 2791627 fixA (M. tuberculosis H37Rv) 20.100
5 3735342 GC GC GC GC GC GI: 13092881 putative S-adenosyl-l-homocysteine hydrolase (Mycobacterium leprae) 40.363
6 4286068 GCG GCG GCG GCG GCG GC IGI: RMMR06009 heat shock protein 70 (M. marinum) 20.395
7 4310932 CCG CCG CCG CCG CCG CC GI: 10579910 phytoene dehydrogenase (Halobacterium spp.) 20.100
8 1028129 GGT GGT GGT GGT GGT GG GI: 3261715 mfd (M. tuberculosis H37Rv) 40.668
9 2955362 TGC TGC TGC TGC TGC TG GI: 2117199 narG (M. tuberculosis H37Rv) 4 0.553
10 3558075 GCC GCC GCC GCC GCC G GI: 1781217 nuoG (M. tuberculosis H37Rv) 30.279
11 1536798 CCG CCG CCG CCG CCG GI: 5524340 PstA (Mycobacterium avium) 40.363
aGI, NCBI gene identification number; IGI, Integrated Genomics gene identification number.
bThe average number of alleles was 3.20.
cD was calculated by using the equation 1 − ∑(allele frequency)2 (22). The average D value was 0.393.
dNo hit, no nucleotide match with any sequences in the GenBank database.
eLocus 3 is located in an intergenic region of two ORFs (6-aminohexanoate-cyclic dimer and hydrolase [the alpha/beta-hydrolase fold]).

List of primers

Repeat and locus Position in genomea SSR Forward primer Forward primer size (bp) Reverse primer Reverse primer size (bp)
    1793091 1793091-1793109 GGGGGGGGGGGG GGGGGGGG TCAGACTGTGCGGTATGGAA 20 GTGTTCGGCAAAGTCGTTGT 20
    2719085 2719085-2719094 GGGGGGGGGG GTGACCAGTGTTTCCGTGTG 20 TGCACTTGCACGACTCTAGG 20
    607784 607784-607794 CG CG CG CG CG C ATCCAACGCCATGTACTCGT 20 GAGCAGCATCGAGGTGAAAC 20
    3406364 3406364-3406373 GC GC GC GC GC GTTCTCGATGGACAGCTTGC 20 GGAGGACGAACCACACTCAT 20
    3735342 3735342-3735351 GC GC GC GC GC TGTCGAACTTGCTCTTGGTG 20 CGTCCTGCAACATCTTCTCC 20
    4286068 4286068-4286084 GCG GCG GCG GCG GCG GC GAATCGTCTTGCCTCACTGG 20 TCGAGCAACTGATCTCCACA 20
    4310932 4310932-4310948 CCG CCG CCG CCG CCG CC CGGCAATACCTCGAACAGAT 20 GCTGAAGAGGTCGTGCAGAT 20
    1028129 1028129-1028145 GGT GGT GGT GGT GGT GG AGATGTCGACCATCCTGACC 20 AAGTAGGCGTAACCCCGTTC 20
    2955362 2955362-2955378 TGC TGC TGC TGC TGC TG GACAAGTTCGGGTTGACCAC 20 AGTTCCTCGACCCAGTCGT 19
    3558075 3558075-3558090 GCC GCC GCC GCC GCC G CTGGAACGTGTCCGAATTG 19 GTATTCGGTGCGGATCTCCT 20
    1536798 1536798-1536812 CCG CCG CCG CCG CCG CTGGAGTGGAAGAGCAGTCC 20 GCTGCGTTACCTCAACACC 19
aThe position in the genome is the coordinate of the SSR locus in the M. paratuberculosis strain K10 genome (GenBank accession number AE016958).