Base de données MAC-INMV-SSR INRA
Accueil
Principe du typage INMV
Identifier vos souches Base de données Téléchargements Références
Principe du typage MLSSR
Actualités Auteurs Nous contacter

Principe du typage

Amorces utilisés

TR no. Position of primer on M. avium subsp. paratuberculosis genome
Predicted size of PCR product (bp) Primer
Tma (°C)Buffer usedb
Start Stop Forward Reverse 1 μl DMSO 5 μl betaine
292 3253590 3253889 300 CTTGAGCAGCTCGTAAAGCGT GCTGTATGAGGAAGTCTATTCATGG 58 +
X3 4441875 4442070 196 AACGAGAGGAAGAACTAAGCCG TTACGGAGCAGGAAGGCCAGCGGG 58
25 3665598 3665947 350 GTCAAGGGATCGGCGAGG TGGACTTGAGCACGGTCAT 58 +
47 4128604 4128821 217 CGTTGCGATTTCTGCGTAGC GGTGATGGTCGTGGTCATCC 64 +
3 131320 131527 208 CATATCTGGCATGGCTCCAG ATCGTGTTGACCCCAAAGAAAT 60 +
7 3711417 3711619 203 GACAACGAAACCTACCTCGTC GTGAGCTGGCGGCCTAAC 60 +
10 4279553 4279855 303 GACGAGCAGCTGTCCGAG GAGAGCGTGGCCATCGAG 60 +
32 1125707 1126004 298 CCACAGGGTTTTTGGTGAAG GGAAATCCAACAGCAAGGAC 55 + +
aTm, melting temperature.
bDMSO, dimethyl sulfoxide. +, used; −, not used. (PCR reaction in 25 µL)

Réprésentation schématique des produits PCR selon génome de K10

sequences